Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.061288 |
Chromosome: | chromosome 9 |
Location: | 2522513 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g391000 | GT90F14,GT90-14 | (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90); GT90 family protein 14 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCGTAAGCACGCTGCTAGCTGCACCTGC |
Internal bar code: | TAGAACCAAAAATACACCAGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1031 |
LEAP-Seq percent confirming: | 99.5403 |
LEAP-Seq n confirming: | 6280 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCATACTCGCCTAAACAGC |
Suggested primer 2: | CCATAGCCACTAGCCAGAGC |