| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.061558 |
| Chromosome: | chromosome 16 |
| Location: | 781282 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g690700 | (1 of 13) IPR000086//IPR015797 - NUDIX hydrolase domain // NUDIX hydrolase domain-like | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGAGGAGTCCGGCGCGACGTAGTGCTGC |
| Internal bar code: | AAGCATTCTGACAAGCTCCGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 703 |
| LEAP-Seq percent confirming: | 99.3711 |
| LEAP-Seq n confirming: | 1422 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTGCACCTGTTTATGCTA |
| Suggested primer 2: | ACACACGACCACACACAGGT |