| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.061678 |
| Chromosome: | chromosome 9 |
| Location: | 3524427 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g389838 | (1 of 1) IPR000504//IPR002750//IPR012677 - RNA recognition motif domain // CobE/GbiG C-terminal domain // Nucleotide-binding alpha-beta plait domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAATCCGTGAGGAGCAGTTGCGAACGAAC |
| Internal bar code: | TCTCCTCCCCGAGTTGGCCCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 692 |
| LEAP-Seq percent confirming: | 98.2186 |
| LEAP-Seq n confirming: | 1213 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCACAGTTGCACATCCAT |
| Suggested primer 2: | AGCAGCTACAACAGCAGCAA |