| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.061876 |
| Chromosome: | chromosome 9 |
| Location: | 1338775 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g398700 | CFA2,CPLD27 | (1 of 1) 2.1.1.140 - (S)-coclaurine-N-methyltransferase; coclaurine N-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATAGGTCTTGTGGGGTGAGGCGTGAGTGC |
| Internal bar code: | CCCTAAACTGATTATCCAGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 536 |
| LEAP-Seq percent confirming: | 99.3458 |
| LEAP-Seq n confirming: | 1063 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTTTACCCCTCCTGCACT |
| Suggested primer 2: | GCTCGCACCTCAAGTACTCC |