| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.062087 |
| Chromosome: | chromosome 6 |
| Location: | 2664093 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g270100 | SBE2a,SBE2 | (1 of 3) 2.4.1.18 - 1,4-alpha-glucan branching enzyme / Glycogen branching enzyme; Starch Branching Enzyme 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCCTACCGCACCCGGTTTTGCTGGTGAC |
| Internal bar code: | TGGCATATGGGCGGTCAAGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 872 |
| LEAP-Seq percent confirming: | 87.672 |
| LEAP-Seq n confirming: | 4779 |
| LEAP-Seq n nonconfirming: | 672 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGCGTGCGAGTATGAGTA |
| Suggested primer 2: | CCACACTCCCCGTGTCTACT |