| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.062143 |
| Chromosome: | chromosome 8 |
| Location: | 4873835 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g384850 | SDR16 | Short-chain dehydrogenase/reductase; (1 of 5) 1.3.1.38 - Trans-2-enoyl-CoA reductase (NADPH) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCCACGATGGTCGCCGCCGCCGACCCCG |
| Internal bar code: | ATCGCTCGTGGCCAGCGCTAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 517 |
| LEAP-Seq percent confirming: | 99.5223 |
| LEAP-Seq n confirming: | 625 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCCATACATGGCAGGAGTC |
| Suggested primer 2: | TAAGGAGCACACTGCACACC |