Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.062147 |
Chromosome: | chromosome 16 |
Location: | 7129607 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g680566 | (1 of 2) K17506 - protein phosphatase 1L [EC:3.1.3.16] (PPM1L, PP2CE) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCAGTAACGGTCAGAGGCGCGGAGGGGGC |
Internal bar code: | CGGGGTCGTAACACGGCCAGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 928 |
LEAP-Seq percent confirming: | 96.7354 |
LEAP-Seq n confirming: | 563 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGCGATGTGCTGTCCTGTC |
Suggested primer 2: | GAAACCATCACCCCAAAATG |