| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.062173 |
| Chromosome: | chromosome 10 |
| Location: | 856672 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g423750 | COQ3 | Hexaprenyldihydroxybenzoate methyltransferase; (1 of 1) 2.1.1.114//2.1.1.222//2.1.1.64 - Polyprenyldihydroxybenzoate methyltransferase / Dihydroxyhexaprenylbenzoate methyltransferase // 2-polyprenyl-6-hydroxyphenol methylase / 2-octaprenyl-6-hydroxyphenol methylase // 3-demethylubiquinol 3-O-methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCGATGCCTTATTCCTATGCCACACGCG |
| Internal bar code: | TGGCAATCTACATTCGCTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 77 |
| LEAP-Seq percent confirming: | 87.5 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGTGTTGCCCCTGTATCT |
| Suggested primer 2: | ACATTTGTAGTTCCCCAGCG |