Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.062322 |
Chromosome: | chromosome 17 |
Location: | 3424870 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g724400 | FAP257 | Flagellar Associated Protein 257; (1 of 3) PF05217 - STOP protein (STOP) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCACTCGCCGCGCCACCCCCCTCCCCTCA |
Internal bar code: | CGACCTATGGGAAGGAACACCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 718 |
LEAP-Seq percent confirming: | 99.0291 |
LEAP-Seq n confirming: | 102 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACAGGGCATTCAGATGGAG |
Suggested primer 2: | TTACACTCGCATTAAGGCCC |