| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.062333 |
| Chromosome: | chromosome 1 |
| Location: | 5281161 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g036900 | (1 of 2) K04427 - mitogen-activated protein kinase kinase kinase 7 (MAP3K7, TAK1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGCTCACCCCCGGTGCCTTTTGCCTGC |
| Internal bar code: | TGGCGACGGAAGAGGGGAGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 173 |
| LEAP-Seq percent confirming: | 30.5218 |
| LEAP-Seq n confirming: | 1205 |
| LEAP-Seq n nonconfirming: | 2743 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTAGTGTCCTCCTCGCTC |
| Suggested primer 2: | GAAGGGGGAAGATGAGGAAG |