| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.062416 |
| Chromosome: | chromosome 11 |
| Location: | 776228 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467635 | MOT22 | Predicted protein; (1 of 1) PF00339 - Arrestin (or S-antigen), N-terminal domain (Arrestin_N) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTTTCCCTCCAGGTTACGCGTGGTCAGG |
| Internal bar code: | CCTCGCGACGGGGCAGGTCCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 825 |
| LEAP-Seq percent confirming: | 99.2193 |
| LEAP-Seq n confirming: | 1398 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGCCGGCTGTACAATGAT |
| Suggested primer 2: | ATGCCGTACATGTCTGTCCA |