| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.062522 |
| Chromosome: | chromosome 2 |
| Location: | 2147941 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g089311 | (1 of 1) PTHR11567:SF110 - TESTICULAR ACID PHOSPHATASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGTTGGGACGACGACTTGTGCGGTAGGA |
| Internal bar code: | CGCACAATTCCCAGGTTTCAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 785 |
| LEAP-Seq percent confirming: | 97.0255 |
| LEAP-Seq n confirming: | 2055 |
| LEAP-Seq n nonconfirming: | 63 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAGGCGCTCATAAAGAAC |
| Suggested primer 2: | ACGTGGAGTTACCAAGTGGC |