| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.062602 |
| Chromosome: | chromosome 16 |
| Location: | 3674004 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g688650 | MOT43 | (1 of 14) PF02493 - MORN repeat (MORN); Predicted protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCAAGCCACTCCTAATCCGCCGCCCATG |
| Internal bar code: | CAGTGGCTGAACTTCTTTCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 860 |
| LEAP-Seq percent confirming: | 97.7386 |
| LEAP-Seq n confirming: | 2939 |
| LEAP-Seq n nonconfirming: | 68 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCGTATCCGTACAGCGACT |
| Suggested primer 2: | CATCCAGTTGTTTGTGGTGC |