Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.062605 |
Chromosome: | chromosome 3 |
Location: | 7942095 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g202150 | DMC2 | (1 of 6) 2.1.1.37 - DNA (cytosine-5-)-methyltransferase / Type II DNA methylase; Putative DNA methylase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATGGCCGCTCGTGCCCAGGTCGGGATGG |
Internal bar code: | TCTTCTGACTTTAGTCTCTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 975 |
LEAP-Seq percent confirming: | 99.7343 |
LEAP-Seq n confirming: | 1126 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGCTGCCGAAATGTCTCTA |
Suggested primer 2: | AGTCACACCATCATCCCCAT |