| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.062631 |
| Chromosome: | chromosome 17 |
| Location: | 4120880 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g729600 | (1 of 11) IPR001471//IPR016177//IPR031112 - AP2/ERF domain // DNA-binding domain // AP2-like ethylene-responsive transcription factor | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACAGGTGGTTATGCCTGAGCAAACTGCC |
| Internal bar code: | CAGGGGAACGAGTCGTGGCAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 722 |
| LEAP-Seq percent confirming: | 96.2817 |
| LEAP-Seq n confirming: | 19343 |
| LEAP-Seq n nonconfirming: | 747 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGCCAAAGTAGGTGGTAGG |
| Suggested primer 2: | GAGGTCACAGGTGAGTGGGT |