| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.062696 |
| Chromosome: | chromosome 16 |
| Location: | 4593475 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g687850 | PTK22 | (1 of 24) IPR006553 - Leucine-rich repeat, cysteine-containing subtype; Protein of unknown function | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGGAGGGGGAGGGGGGGTGCCGGTAATC |
| Internal bar code: | TCTGGAAAGCTAGTTCCGCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 162 |
| LEAP-Seq percent confirming: | 80.5651 |
| LEAP-Seq n confirming: | 1882 |
| LEAP-Seq n nonconfirming: | 454 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGTCACCATGTTTTGCAC |
| Suggested primer 2: | AATCCGCGCATAATCAATTC |