| Insertion cassette: | CIB1 | 
| Side of cassette: | 3' | 
| Strand: | - | 
| Strain: | LMJ.RY0402.062712 | 
| Chromosome: | chromosome 12 | 
| Location: | 2940669 | 
| Confidence (%): | 58 | 
| Locus systematic id | Locus common name | Defline | Feature | 
|---|---|---|---|
| Cre12.g501600 | BLZ8 | (1 of 6) PF07716 - Basic region leucine zipper (bZIP_2); bZIP transcription factor | 3'UTR | 
| Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGGGTCACTGGTACCCTCGTTCTATCGT | 
| Internal bar code: | TCTGGCAGGTAGTGACGGAGAC | 
| Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 482 | 
| LEAP-Seq percent confirming: | 98.8783 | 
| LEAP-Seq n confirming: | 2997 | 
| LEAP-Seq n nonconfirming: | 34 | 
| LEAP-Seq n unique pos: | 30 | 
| Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGGGCGAGACTAGACAAC | 
| Suggested primer 2: | TCCCGCACCTTATACTGACC |