Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.062782 |
Chromosome: | chromosome 10 |
Location: | 5437356 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g458450 | GPX5,GPXH | Glutathione peroxidase 5; (1 of 4) 1.11.1.9 - Glutathione peroxidase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAGTCACCCACTTGAACACGGGGTTGGC |
Internal bar code: | GAACAGGCCATCGCCTAGCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 798 |
LEAP-Seq percent confirming: | 99.5056 |
LEAP-Seq n confirming: | 3220 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCTCCACAATCAAAGCAAT |
Suggested primer 2: | AACCAATCGCCTAACACCTG |