| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.062928 |
| Chromosome: | chromosome 1 |
| Location: | 4259525 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g028550 | OTU1 | (1 of 1) PTHR12419:SF10 - PROTEIN OTUB-3, ISOFORM B; OTU-like cysteine protease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCAATACGGGTGTGGTACAATGTTATGCA |
| Internal bar code: | GAGTCCGCGTGCGACGCAGAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 300 |
| LEAP-Seq percent confirming: | 90.475 |
| LEAP-Seq n confirming: | 7048 |
| LEAP-Seq n nonconfirming: | 742 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTAGTATCGCCATGCCACC |
| Suggested primer 2: | TTTCCTGCCTCAAAAGTGCT |