Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.063049 |
Chromosome: | chromosome 13 |
Location: | 4168356 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g592100 | (1 of 1) PF00097//PF00628 - Zinc finger, C3HC4 type (RING finger) (zf-C3HC4) // PHD-finger (PHD) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGCAGCGAATGGGAGCCAGTGTCATGCT |
Internal bar code: | CAGGACCGGGGGGCGATATAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 392 |
LEAP-Seq percent confirming: | 95.2381 |
LEAP-Seq n confirming: | 40 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAGCGGTCCTTGTCCATGT |
Suggested primer 2: | GTGGAGTCTGCGTTCAACCT |