| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.063167 |
| Chromosome: | chromosome_3 |
| Location: | 5255954 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre03.g183200 | CPC1 | Protein associated with central pair microtubule complex | antisense | CDS |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | GTTTTTGCCGCCTGCAAGCAGCGCCGCCGC |
| Internal bar code: | GCTCACGTCGGCATCCTACGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 152 |
| LEAP-Seq percent confirming: | 84.0909 |
| LEAP-Seq n confirming: | 814 |
| LEAP-Seq n nonconfirming: | 154 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTCCAGCGTCTTCCACTC |
| Suggested primer 2: | CTGGATCTGGACAGTGAGCA |