| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.063259 |
| Chromosome: | chromosome 2 |
| Location: | 5079320 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g104800 | HTV1 | (1 of 35) IPR000164//IPR007125//IPR009072 - Histone H3/CENP-A // Histone H2A/H2B/H3 // Histone-fold; Histone H3 variant | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGACGGCGTGCACCGACACCAGAAGACA |
| Internal bar code: | CTCTGGAGTACTCGTCTGGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 374 |
| LEAP-Seq percent confirming: | 99.6749 |
| LEAP-Seq n confirming: | 2146 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGGAAGTTGCGTGTGTAA |
| Suggested primer 2: | GCTGCATTTTAACGAGCACA |