| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.063427 |
| Chromosome: | chromosome 11 |
| Location: | 3532153 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g481400 | (1 of 1) K08864 - tousled-like kinase [EC:2.7.11.1] (TLK) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCAAATCTAGATTTCGCGCTGTTTCGCC |
| Internal bar code: | GGCAAGGGTTCCCGCCGCGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 293 |
| LEAP-Seq percent confirming: | 7.82609 |
| LEAP-Seq n confirming: | 27 |
| LEAP-Seq n nonconfirming: | 318 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGTGGGACGTTGTTCACT |
| Suggested primer 2: | CAGCAGCCAATGAGAAACAA |