| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.063485 |
| Chromosome: | chromosome 2 |
| Location: | 661726 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g078100 | EIF5Ba,EIF5B1 | (1 of 1) K03243 - translation initiation factor 5B (EIF5B); Eukaryotic initiation factor, eIF-5B | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGGGAAGGCTACGGGCTGGATCAAGGTC |
| Internal bar code: | AGCAGAAGTCGAATAGGCAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1250 |
| LEAP-Seq percent confirming: | 98.8925 |
| LEAP-Seq n confirming: | 4554 |
| LEAP-Seq n nonconfirming: | 51 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCCCAGTCGTGTCATTCT |
| Suggested primer 2: | CGTGGTCATCAAGCTCAAGA |