Insertion junction: LMJ.RY0402.063544_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.063544
Chromosome:chromosome_8
Location:4930358
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g385250 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CTGCTGGAGCCCACCATCGAGCCGGGCTCC
Internal bar code:TTGGCGCGCCCCTTTCGCTCGC

Confirmation - LEAP-Seq

LEAP-Seq distance:795
LEAP-Seq percent confirming:99.4624
LEAP-Seq n confirming:3330
LEAP-Seq n nonconfirming:18
LEAP-Seq n unique pos:24

Suggested primers for confirmation by PCR

Suggested primer 1:CAAGGTGGTGGACATCAGTG
Suggested primer 2:GAGCTTCAGCTCAGCAAACC