| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.063576 |
| Chromosome: | chromosome 10 |
| Location: | 3254888 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g443050 | PFH3,PHX15,P4H3 | Prolyl 4-hydroxylase 3; (1 of 14) K00472 - prolyl 4-hydroxylase (E1.14.11.2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTAAATGATTCTGACCAAGGCTGCGGGCA |
| Internal bar code: | TGGCCGTTAACGGGTCCGAAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 998 |
| LEAP-Seq percent confirming: | 93.7805 |
| LEAP-Seq n confirming: | 1538 |
| LEAP-Seq n nonconfirming: | 102 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGAGCAGGCTGAGATGATT |
| Suggested primer 2: | CTTCGCAAATGTCGTCTCAA |