Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.063620 |
Chromosome: | chromosome 1 |
Location: | 5004989 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g034550 | FAP109 | (1 of 2) IPR002048//IPR003117 - EF-hand domain // cAMP-dependent protein kinase regulatory subunit, dimerization-anchoring domain; EF-Hand Containing Flagellar Associated Protein 109 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCTCCATCTCCCGTCGGCCCGCGCCAAC |
Internal bar code: | CGACGTGGGTTTAATCAAGGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 628 |
LEAP-Seq percent confirming: | 99.8275 |
LEAP-Seq n confirming: | 12731 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCAAGTTGCTGGAGCTGTT |
Suggested primer 2: | TCTGCGACCTCCTAAGCAAT |