| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.063673 |
| Chromosome: | chromosome 9 |
| Location: | 5010281 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g398067 | FKB62,ROF1 | Peptidyl-prolyl cis-trans isomerase, FKBP-type; (1 of 1) PTHR10516:SF324 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP62 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGTGTGTGTATTGCGTGAGGGGTTGTT |
| Internal bar code: | GAATAACTATTTGTTCGCGCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 308 |
| LEAP-Seq percent confirming: | 94.7971 |
| LEAP-Seq n confirming: | 911 |
| LEAP-Seq n nonconfirming: | 50 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACTAACCGCATGGGAACAG |
| Suggested primer 2: | AGTGCAACGGCAGTGTGTAG |