Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.063721 |
Chromosome: | chromosome 6 |
Location: | 7948051 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g303500 | (1 of 1) K13101 - G patch domain and KOW motifs-containing protein (GPKOW) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGATGTGTGGGAGCAGCCAGGAGGGCCCA |
Internal bar code: | GGGTTATCTCTTAGCCGAACAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 587 |
LEAP-Seq percent confirming: | 99.6783 |
LEAP-Seq n confirming: | 14564 |
LEAP-Seq n nonconfirming: | 47 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCTACGTTCCCAACCCTTT |
Suggested primer 2: | GGGTGAGATGACGAGGACAT |