| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.063734 |
| Chromosome: | chromosome 6 |
| Location: | 1442843 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g259200 | EFS2,EFS1,SELB,SELB1 | Selenocysteine-specific elongation factor EF-Sec; (1 of 1) PTHR23115:SF91 - SELENOCYSTEINE-SPECIFIC ELONGATION FACTOR | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACCCCACCCCTCGCCCGACGGGCCTCGT |
| Internal bar code: | GGCAGGTGGCACGATGCGCATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 876 |
| LEAP-Seq percent confirming: | 70.7771 |
| LEAP-Seq n confirming: | 1521 |
| LEAP-Seq n nonconfirming: | 628 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAACTGCAGCTCGTCGTA |
| Suggested primer 2: | GAGCGATAAGAAGGCCACAG |