| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.063800 |
| Chromosome: | chromosome 17 |
| Location: | 6929303 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g745947 | (1 of 71) IPR016181 - Acyl-CoA N-acyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGTTACTGCACAACCCTTTCTATTCCGC |
| Internal bar code: | TCCCATGAACGTTTCGGTCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 432 |
| LEAP-Seq percent confirming: | 99.7047 |
| LEAP-Seq n confirming: | 1688 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTCCTCAACCACCTCATC |
| Suggested primer 2: | GGTCATCGTCCCAAATCATC |