Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.064007 |
Chromosome: | chromosome 1 |
Location: | 2993838 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g018400 | ITPK2,IPK | (1 of 2) K00913 - inositol-1,3,4-trisphosphate 5/6-kinase / inositol-tetrakisphosphate 1-kinase (ITPK1); Inositol 1%252C3%252C4-trisphosphate 5/6-kinase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCATTTTTGGACTACGGTGCATTCCCGCT |
Internal bar code: | TAGGTGAAAGCGTCATGTCGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1047 |
LEAP-Seq percent confirming: | 98.4172 |
LEAP-Seq n confirming: | 7586 |
LEAP-Seq n nonconfirming: | 122 |
LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCTTGTTGAGGCTGACTTC |
Suggested primer 2: | TGAGACTGAATGCTGCCAAC |