| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.064048 |
| Chromosome: | chromosome 16 |
| Location: | 2136851 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g658000 | Putative metallochaperone; (1 of 2) IPR003495//IPR027417 - CobW/HypB/UreG domain // P-loop containing nucleoside triphosphate hydrolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGTGCAGTCTCGGTGGGGACGTCGCAGC |
| Internal bar code: | GCGTAAACCGGGATGAGGCAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 996 |
| LEAP-Seq percent confirming: | 47.8905 |
| LEAP-Seq n confirming: | 1294 |
| LEAP-Seq n nonconfirming: | 1408 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAAGGCATCTTCAGGTGGG |
| Suggested primer 2: | GAGACTGCACTCGTGATGGA |