Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.064060 |
Chromosome: | chromosome 9 |
Location: | 865116 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g401600 | (1 of 1) IPR014560 - Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTGCTTACGGCTGCCAGAGGCATGATGG |
Internal bar code: | ATACCGATCCCAACACGGGTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 266 |
LEAP-Seq percent confirming: | 89.9476 |
LEAP-Seq n confirming: | 3776 |
LEAP-Seq n nonconfirming: | 422 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCACACATTCTTTGGGCTC |
Suggested primer 2: | TGCTATCAAGCCAAGACACG |