| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.064060 |
| Chromosome: | chromosome 9 |
| Location: | 865116 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g401600 | (1 of 1) IPR014560 - Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTGCTTACGGCTGCCAGAGGCATGATGG |
| Internal bar code: | ATACCGATCCCAACACGGGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 266 |
| LEAP-Seq percent confirming: | 89.9476 |
| LEAP-Seq n confirming: | 3776 |
| LEAP-Seq n nonconfirming: | 422 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCACACATTCTTTGGGCTC |
| Suggested primer 2: | TGCTATCAAGCCAAGACACG |