Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.064125 |
Chromosome: | chromosome 5 |
Location: | 3167373 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g239500 | FAP38 | (1 of 1) IPR000104//IPR009068 - Antifreeze protein, type I // S15/NS1, RNA-binding; Flagellar Associated Protein 38 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCCAAACTAACCCGGGGGGAGTGTGCAG |
Internal bar code: | CGATCGCGAAAACGTTTGTCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 10 |
LEAP-Seq percent confirming: | 99.2683 |
LEAP-Seq n confirming: | 407 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGGAGCACATGTTCAAGCA |
Suggested primer 2: | ACAATGGCGGTTTTGATAGC |