| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.064150 |
| Chromosome: | chromosome 17 |
| Location: | 5123198 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g735021 | (1 of 6) PTHR10582 - TRANSIENT RECEPTOR POTENTIAL ION CHANNEL PROTEIN | intron|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCACGGGGTCTCCCCATGTGCACTCAAC |
| Internal bar code: | GAGGCAGGATTTTTGGTGGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 527 |
| LEAP-Seq percent confirming: | 99.0465 |
| LEAP-Seq n confirming: | 4051 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGAGTCTGCCTCCTCACA |
| Suggested primer 2: | GGTCAGGGTCATCTACGCAT |