Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.064150 |
Chromosome: | chromosome 17 |
Location: | 5123198 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g735021 | (1 of 6) PTHR10582 - TRANSIENT RECEPTOR POTENTIAL ION CHANNEL PROTEIN | intron|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCACGGGGTCTCCCCATGTGCACTCAAC |
Internal bar code: | GAGGCAGGATTTTTGGTGGGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 527 |
LEAP-Seq percent confirming: | 99.0465 |
LEAP-Seq n confirming: | 4051 |
LEAP-Seq n nonconfirming: | 39 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATGAGTCTGCCTCCTCACA |
Suggested primer 2: | GGTCAGGGTCATCTACGCAT |