| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.064159 |
| Chromosome: | chromosome 17 |
| Location: | 4152621 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g729800 | ALB3B | ALBINO3-like translocon protein; (1 of 3) K03217 - YidC/Oxa1 family membrane protein insertase (yidC, spoIIIJ, OXA1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCTGCACGCCATTTCATGAGGGGCGTTT |
| Internal bar code: | CCGGGGCGAATGCTGCTTGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 839 |
| LEAP-Seq percent confirming: | 98.9856 |
| LEAP-Seq n confirming: | 1854 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTGCTTTTCCTGTTTGTG |
| Suggested primer 2: | CTTTCTCACCAGCCCCATAA |