| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.064348 |
| Chromosome: | chromosome 10 |
| Location: | 1185689 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g426200 | RAP4,OPR44,CLR21 | OctotricoPeptide Repeat protein 44; (1 of 39) PF08373 - RAP domain (RAP) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTGGCGGTTTGTGGGTTGGTGCTTTACA |
| Internal bar code: | CTGTTCAGCTTCGACGGGTTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1062 |
| LEAP-Seq percent confirming: | 98.6794 |
| LEAP-Seq n confirming: | 5380 |
| LEAP-Seq n nonconfirming: | 72 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAAGTTCTCTTGGGCTGAC |
| Suggested primer 2: | AGGAGGATGAGGAGGAGAGC |