| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.064396 |
| Chromosome: | chromosome 5 |
| Location: | 246876 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g233650 | FXL9 | (1 of 2) IPR000014//IPR011990 - PAS domain // Tetratricopeptide-like helical domain; FixL-like PAS domain protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAACAACGCCGCCTAGCGACGAGTTAGAC |
| Internal bar code: | AGCTCTAGCCCCGGGCGATACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 659 |
| LEAP-Seq percent confirming: | 98.7977 |
| LEAP-Seq n confirming: | 7889 |
| LEAP-Seq n nonconfirming: | 96 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGTCCTCTCTGCCCTTTG |
| Suggested primer 2: | TCGTTTCTGTTCTGCAGTGG |