| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.064450 |
| Chromosome: | chromosome 14 |
| Location: | 626145 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g612150 | MOT18,PAP10 | Class-II RNA nucleotidyl transferase 10; (1 of 1) K14079 - poly(A) RNA polymerase GLD2 [EC:2.7.7.19] (PAPD4, GLD2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCGGGGACGGAGTGCCGGGTGCTAGTCG |
| Internal bar code: | AGTGATGGGCGCGATCCCAGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1011 |
| LEAP-Seq percent confirming: | 99.7334 |
| LEAP-Seq n confirming: | 3741 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGTCACCCATGTCGTCAG |
| Suggested primer 2: | TTGCAATTCTTAGCCATCCC |