Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.064515 |
Chromosome: | chromosome 17 |
Location: | 193404 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g697500 | P25 Alpha Domain and EF Hand Protein; (1 of 2) PTHR12932:SF9 - TPPP FAMILY PROTEIN CG45057 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGCGTGCTAATTTTAAGACGCTGTTCGC |
Internal bar code: | CCCGAGAGTCGGACGCGAGGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 579 |
LEAP-Seq percent confirming: | 82.2639 |
LEAP-Seq n confirming: | 1141 |
LEAP-Seq n nonconfirming: | 246 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACACCACACAAGCACATCC |
Suggested primer 2: | CCTTCATTTTTGGCCTGTGT |