| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.064560 |
| Chromosome: | chromosome 8 |
| Location: | 3429566 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g374700 | FAP244 | (1 of 2) PTHR14885:SF1 - WD REPEAT-CONTAINING PROTEIN 96; Flagellar Associated Protein 244 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTCCCCTCTCTCCCCCGGCGACGATTCC |
| Internal bar code: | TAATTTTGCCGTATCGTATGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 168 |
| LEAP-Seq percent confirming: | 99.5833 |
| LEAP-Seq n confirming: | 1434 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATTTGCTCCCGGTACTCCT |
| Suggested primer 2: | AGGTACCCCACTCCAGCTTT |