| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.064593 |
| Chromosome: | chromosome 2 |
| Location: | 2187608 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g089608 | (1 of 1) K11136 - regulator of telomere elongation helicase 1 [EC:3.6.4.12] (RTEL1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGCGGAGTGTCGATGCCTTCCTACCTAC |
| Internal bar code: | GTAGGTGGCCGCGAGCTCAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 125 |
| LEAP-Seq percent confirming: | 99.2479 |
| LEAP-Seq n confirming: | 3299 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCCACCTGCCCTTACCTT |
| Suggested primer 2: | AGCCTCAAGTTCGGCAAGTA |