| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.064593 |
| Chromosome: | chromosome 16 |
| Location: | 3881495 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g690150 | ALG6,GTR21 | (1 of 1) 2.4.1.267 - Dolichyl-P-Glc:Man(9)GlcNAc(2)-PP-dolichol alpha-1,3-glucosyltransferase / Dol-P-Glc:Man(9)GlcNAc(2)-PP-Dol alpha-1->3-glucosyltransferase; Alpha-1%252C3-glucosyltransferase 6 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTTGGCTGCGTCATGGCGCATGTATAAA |
| Internal bar code: | ACGAGCGCGCGGTGGCAGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 140 |
| LEAP-Seq percent confirming: | 98.9005 |
| LEAP-Seq n confirming: | 1799 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACACAGCCTCGAAGACACA |
| Suggested primer 2: | GCCATGTGTTTGTGGTTGAG |