| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.064627 |
| Chromosome: | chromosome 6 |
| Location: | 4077995 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278215 | HIBCH1 | (1 of 1) 3.1.2.4 - 3-hydroxyisobutyryl-CoA hydrolase; 3-hydroxyisobutyryl-CoA hydrolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAAAAGAATTTCGTCCGCCAGAGGCCTTT |
| Internal bar code: | TGCCAACCGGCGTTCCGGGCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 647 |
| LEAP-Seq percent confirming: | 99.2503 |
| LEAP-Seq n confirming: | 3442 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACTCCTTGATGCGCTAA |
| Suggested primer 2: | ACTCACATCTTGTACCCGCC |