Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.064655 |
Chromosome: | chromosome 16 |
Location: | 7759645 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g692116 | (1 of 3) PTHR23505:SF12 - MAJOR FACILITATOR PROTEIN | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCACGCCATCGGGAACCAGCTTCTCAGAC |
Internal bar code: | TGGGGCCGGCTTATTTCCTGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1055 |
LEAP-Seq percent confirming: | 99.4245 |
LEAP-Seq n confirming: | 5010 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCTTGTGTCTTCAATGCCC |
Suggested primer 2: | TACAACCACCCAAAACAGCA |