| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.064671 |
| Chromosome: | chromosome 10 |
| Location: | 4488339 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g451752 | PHC25 | Putative pherophorin-chlamydomonas homolog; (1 of 71) PF12499 - Pherophorin (DUF3707) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTTGTGAAGGTCTGCGACGTCAGAAGTT |
| Internal bar code: | GTTTCGGTTAATTATGAATGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 705 |
| LEAP-Seq percent confirming: | 99.0198 |
| LEAP-Seq n confirming: | 5960 |
| LEAP-Seq n nonconfirming: | 59 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACAGCAGTCGGAGTAACGA |
| Suggested primer 2: | TATGAACCACGTGCAGGGTA |