| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.064725 |
| Chromosome: | chromosome 16 |
| Location: | 1661612 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g654550 | (1 of 5) 1.14.11.27 - [Histone H3]-lysine-36 demethylase / JmjC domain-containing histone demethylase 1A | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCGCTTTTGACACGTGGGACGCCTGGTG |
| Internal bar code: | CCTATCTGCATTCCGTCATAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 784 |
| LEAP-Seq percent confirming: | 85.6314 |
| LEAP-Seq n confirming: | 4279 |
| LEAP-Seq n nonconfirming: | 718 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAGCAGCAGCAGTCACAG |
| Suggested primer 2: | CGTCATTTTCCGGCTACAAT |