Insertion junction: LMJ.RY0402.064848_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.064848
Chromosome:chromosome_10
Location:1647883
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):AGGTGGGGCGAGGTGAGGTGAGGTGGGATC
Internal bar code:GAATCGGATTTCCGGGAAGGCT

Confirmation - LEAP-Seq

LEAP-Seq distance:614
LEAP-Seq percent confirming:98.2272
LEAP-Seq n confirming:5042
LEAP-Seq n nonconfirming:91
LEAP-Seq n unique pos:28

Suggested primers for confirmation by PCR

Suggested primer 1:CCTCTCCAGCTCACCTCAAC
Suggested primer 2:TCAACAGCATCAAGCAGGTC