Insertion junction: LMJ.RY0402.064848_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.064848
Chromosome:chromosome_10
Location:1648296
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):ATGGCTGCGCAGACTTCGTGGTGAAGGGGG
Internal bar code:GTCTTATAACCGCCTCGCGTAT

Confirmation - LEAP-Seq

LEAP-Seq distance:39
LEAP-Seq percent confirming:0.678733
LEAP-Seq n confirming:3
LEAP-Seq n nonconfirming:439
LEAP-Seq n unique pos:1

Suggested primers for confirmation by PCR

Suggested primer 1:ACACATCAAAGCCTCCCAAC
Suggested primer 2:CCCACACCTACCTTGCTTGT